The length of a rectangle is twice the width. An equation that models the perimeter of the rectangle is 2w+4w=36 where w is the width of the rectangle is ft. What are the length and width of the rectangle?

Answers

Answer 1

Answer: 12

Step-by-step explanation:

Let w = the width of the rectangle

Let 2w = the length

P = 2l + 2w

36 = 2(2w) + 2w

36 = 4w + 2w

36 = 6w

w = 6

l = 2(6)

l = 12

Answer 2

Answer:

shes right the person ahade of me


Related Questions

An item is regularly priced at $43. Charmaine bought it at a discount of 95% off the regular price. How much did Charmaine pay?​

Answers

Answer:

Charmaine paid $2.15

Step-by-step explanation:

So Charmaine only paid for 5% of the regular price

5/100×$43=5×$0.43

=$2.15

Answer:

2.15$

Step-by-step explanation:

95% of 43 is 40.85

43 - 40.85 = 2.15

Jackson biked k kilometers. Maria biked 8 more kilometers than Jackson. Peter biked 2 fewer kilometers than Jackson.

Drag and drop the expressions into the boxes to write an expression that represents the total number of kilometers Jackson, Maria, and Peter biked in all.

k
8
12
k+2
k+8
k+10
k-2
k-8

Answers

Answer:

Step-by-step explanation:

The expression for the total distance covered.

k + (k + 8) + (k - 2)

What is an expression?

An expression is a way of writing a statement with more than two variables or numbers with operations such as addition, subtraction, multiplication, and division.

Example: 2 + 3x + 4y = 7 is an expression.

We have,

Distance biked:

Jackson = k

Maria = k + 8

Peter = k - 2

Now,

The total distance biked.

= k + k + 8 + k - 2

= 3k + 6

= 3 (k + 2)

Thus,

The total distance covered is 3 (k + 2).

Learn more about expressions here:

https://brainly.com/question/3118662

#SPJ2

given f(x)=2x-3, find f(1)

Answers

Answer:

-1

Step-by-step explanation:

the 1 substitutes the x so plug in 1 for x

2(1) - 3 = 2-3= -1

A cable company charges 150 to install equipment. Then there is a $50 charge each month. Write an equation to express this relationship

Answers

The equation would be: 150 + (50x) = total

Really need this B is perimeter D is volume if you couldn't see it.​

Answers

Answer:

B

Step-by-step explanation:

yea

Answer:

a) area

Step-by-step explanation:

well you just need to find the carpet area. carpet is just for the floor, so you don't need the perimeter, volume is for 3D figures, and surface area is for the outside of an object. carpet is a 2D figure, so the answer is a) area :)

hope this helps!

Help pls! Extra p! Thank youu

Answers

Answer:

(C) 48 ft^3

Step-by-step explanation:

Volume=L*W*H=6*4*2=24*2=48, making the correct choice (C) 48 ft^3

Find the length of side a.
A. 2
B. 3
C. 34
D. 9​

Answers

It’s B


You need to use the Pythagorean theorem which is a squared + b squared = c squared

So a^2+4^2=5^2
Simplified that would be a^2 + 16 = 25

Subtract 16 from both sides
A^2=9

And the square root of nine is 3

What’s the solution for b/2= 9

Answers

Answer:

18

Step-by-step explanation:

2 x 9 = 18

b = 18

Solve for  b  by simplifying both sides of the equation, then isolating the variable.

3. Create three quadratic equations that has one real solution.​

Answers

Three quadratic equations that have one real solution are show below:

5x^2+3x^3+3^4 = 55

5x^2+3x^3+3^7 = 55

5x^2+3x^3+3^8 = 55

What do 5.75 and 8.75 have in common

Answers

They have 0.75 as their decimal

Answer:

Least common multiple (also called the lowest common multiple or smallest common multiple or LCM) of one or more integer numbers

Step-by-step explanation:

which equation represents this graph?

Answers

Answer:

It would be the 1st answer, y= 3/2x + 2.

Step-by-step explanation:

The intersection on the Y axis determins the "+2". To find the slope, it is always x/y. It rises 3, and runs 2. Hope this helps

Can someone please answer my question? i have been working on school work all day.
here is 30 points just please answer all my questions that i post and i will give more

Write the sum, and then write an equivalent expression by collecting like terms and removing parentheses.

b. 2x - 7 and the opposite of 2x

Answers

Answer:

-70x

Step-by-step explanation:

2.) The highest spot in Town X is 4 1/3 times taller than the highest spot in
Town Y. If the tallest spot in Town Y is 72 meters high, how high is the
tallest spot in Town X?

Answers

Answer:

312 meters

Step-by-step explanation:

X = [tex]\frac{13}{3}[/tex] · [tex]\frac{72}{1}[/tex]

X = 13 · 24

Mrs. Pena is buying 3 kinds of sandwiches for a family reunion. She buys x egg salad sandwiches at $3.10 each. She buys
y corned beef sandwiches at $3.35 each. Finally, she buys z cheese sandwiches at $2.85 each. Mrs. Pena spent a total of
$148.55 on the sandwiches. Which equation could be used to represent the situation?
A 3.10x + 3.35y + 2.85z = 148.55
00
(3.10 + 3.35 + 2.85)xyz = 148.55
(x + y + 2)(3.10 + 3.35 + 2.85) = 148.55
D
x + y + z = 148.55

Answers

The answer is A since there are x egg sandwiches that cost $3.10, y beef that cost $3.35 and z cheese sandwiches that cost $2.85, so buying one more of any of those would mean paying that amount a the number of times you buy it. So 2 of x is $3.10 x 2 = $

change 9.65kg into grams

Answers

Answer:

9650

Step-by-step explanation:

Step-by-step explanation:

=(9.65×1000) grams

=9650grams

hope it helps.

What is the value of Angle 'a'?
a
47°

Answers

Answer:

133

Step-by-step explanation:

180-47=133

Answer: if the shape is a triangle, 180-47=133

if it is any other shape, 360-47=313

Step-by-step explanation:

I don’t get 9.) so if anyone can’t skip it I need help with 10.) too

Answers

Answer:

ok number 9.) i believe its 7 if im wrong im so sorry

Step-by-step explanation:

Answer:

I will help with 10 i don't get 9 sorry so the answer is (a) F(5,4)

Step-by-step explanation:

So you have the midpoint and you put f(x, y) and D(-3,-8)

So

E=(x-3/2, y-8/2) =(1,-2) so

X-3/2 =1 , x-3=2 so x = 5

And y-8/2 = - 2. , so y-8 = - 4. , so y =4

So F =(5, 4)

NEED HELP NOW!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Factor completely 5x2 − 5x − 100.

Answers

Answer:

5(x - 5)(x + 4)

Step-by-step explanation:

Given

5x² - 5x - 100 ← factor out 5 from each term

= 5(x² - x - 20) ← factor the quadratic

Consider the factors of the constant term (- 20) which sum to give the coefficient of the x- term (- 1)

The factors are - 5 and + 4, since

- 5 × 4 = - 20 and - 5 + 4 = - 1, then

x² - x - 20 = (x - 5)(x + 4) and

5x² - 5x - 100 = 5(x - 5)(x + 4)

Answer:

Step-by-step explanation:

here you go mate

step 1

5x2 − 5x − 100  equation

step 2

5x2 − 5x − 100  factor

5x^2 - 5x - 100 = 5

answer

5(x+4)(x-5)

10 builders can build a house in 20 days. How many builders
will you need build the house in 10 days?

Answers

Answer:

20 builders

Step-by-step explanation:

Answer: 20 builders.

Step-by-step explanation: For 10 builders to build a house in 20 days, the ratio is 1:2. For builders to build a house in 10 days, the ratio is x:10. You then cross multiply 1:2 and x:10. Then x=20 so 20 builders.

6x + 10 = - 2y
y=mx+b

Answers

Answer:

y = -3x - 5

Step-by-step explanation:

-2y = 6x + 10

divide both sides by -2

y = -3x - 5

(I need to turn this in tomorrow, please help)

Answers

2,4 is the answer for the table. the answer for the graph is 1/4 maybe?? i’m not to sure on the graph

Evaluate each algebraic expression for x = -2,3, -0.5, and 1 1/2
2). 4X. 3) 3x+2

PLEASE HELP URGET!!

Answers

Answer:

Step-by-step explanation:

2. 4x= 4*(-2)=-8

4x=4*(3)=12

4x=4*(-0.5)=-2

4x=4*3/2=6

the 3x+2

3x+2=3*(-2)+2=-6+2=-4

3x+2=3*(3)+2=11

3x+2=3*(-0.5)+2=-1.5+2=0.5

3x+2=3*(3/2)+2=9/2+2=13/2=6 1/2

Which expressions are equal to 105?

Answers

Answer:

2•2²×100+5.

Step-by-step explanation:

please help this is so confusing u can have 25 points if u help me

share 20 pounds into the ratio 2:3
share 15cm in the ratio 1:3

Answers

Step-by-step explanation:

Share 20pounds in the ratio 2:3

Total ratio=2+3=5

2/5×20=8

20-8=12

Sharing 20pounds in that ratio gives 8pounds:12pounds

Share 15cm in the ratio 1:3

Total ratio=1+4=4

¼×15=3.75

15-3.75=11.25

Sharing 15cm in that ratio gives 3.75:11.25

Which value of x satisfies the equation } (x – 3) = -12
-8
7
- 7
8

Answers

Answer:

x = -8

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Equality Properties

Step-by-step explanation:

Step 1: Define

(x - 3) = -12

Step 2: Solve for x

Add 3 to both sides:          x = -8

Pls help it due in a hour

Answers

Answer:

The coordinates of the Midpoint of AB will be: (1/2, 5)

Step-by-step explanation:

Given the points

A(-2, 6)B(3, 4)

Finding the midpoint between (-2, 6) and (3, 4)

[tex]\mathrm{Midpoint\:of\:}\left(x_1,\:y_1\right),\:\left(x_2,\:y_2\right):\quad \left(\frac{x_2+x_1}{2},\:\:\frac{y_2+y_1}{2}\right)[/tex]

[tex]\left(x_1,\:y_1\right)=\left(-2,\:6\right),\:\left(x_2,\:y_2\right)=\left(3,\:4\right)[/tex]

[tex]M.P=\left(\frac{3-2}{2},\:\frac{4+6}{2}\right)[/tex]

        [tex]=\left(\frac{1}{2},\:5\right)[/tex]

Therefore, the coordinates of the Midpoint of AB will be: (1/2, 5)

i dont know how to do geometry like that and i need help on my assignment ​

Answers

Answer:

Step-by-step explanation:  Can you ask your teacher? Or no?

I’m going from left to right on answers, just so you know.
Alternate interior, vertical, alternate exterior, same side interior, same side exterior, same side interior, corresponding.

Fill in the blanks needs to be done by 9:30!!

Answers

Answer:

1. Straight line

2. mx+b

3. slope , y intercept

4. dont know sorry

Step-by-step explanation:

The blanks are: (in order)

•Straight Line
•Mx+b
• (not sure)
• (not sure)
•constant

Help me plz!
9ubiesnfhduryinwiwybv

Answers

Answer:

-8

Step-by-step explanation:

10 -2b^2

Let b=-3

10 - 2( -3)^2

Do the exponent first

10 -2(9)

Multiply

10 -18

Subtract

-8

Answer:

- 8

Step-by-step explanation:

Given

10 - 2b² ← substitute b = - 3 into the expression

= 10 - 2(- 3)²

= 10 - 2(9)

= 10 - 18

= - 8



Kim and Melody are selling popcorn buckets for a school fundraiser. Customers can buy small buckets or large buckets. Kim sold 3 small buckets and 14 large buckets of popcorn for a total of $206. Melody sold 11 small buckets and 11 large buckets of popcorn for a total of $231. What is the cost for a small bucket and a large bucket of popcorn?

Answers

Answer:

The cost of

A small bucket = x = $8

A Larger bucket = y = $13

Step-by-step explanation:

Let the cost of

A small bucket = x

A Larger bucket = y

Kim sold 3 small buckets and 14 large buckets of popcorn for a total of $206.

3x + 14y = 206... Equation 1

Melody sold 11 small buckets and 11 large buckets of popcorn for a total of $231.

11x + 11y = 231.... Equation 2

What is the cost for a small bucket and a large bucket of popcorn?

3x + 14y = 206... Equation 1

11x + 11y = 231 ....... Equation 2

We solve using Elimination method

Multiply Equation 1 by 11 and Equation 2 by 3 to Eliminate x

33x + 154y = 2266.... Equation 3

33x + 33y = 693....... Equation 4

We subtract Equation 4 from Equation 3

121y = 1573

y = 1573/121

y = $13

Solving for x

3x + 14y = 206... Equation 1

3x + 14 × 13 = 206

3x + 182 = 206

3x = 206 - 182

3x = 24

x = 24/3

x = $8

Hence, the cost of

A small bucket = x = $8

A Larger bucket = y = $13

Other Questions
. Jackson is a modern-day psychologist who practices in a way that echoes Freud by working with the id, super-ego, and ego. What type of psychology does Jackson MOST likely practice? biological psychology cultural psychology behavioral psychology psychodynamic psychology Knowing how food choices impact the function and productivity of cells, why do you think it is important to maintain a healthy diet? What can happen if someone continually eats junk food? 4 Complete the sentences with the correct form of the verbs in brackets.1 Tim isnt here at the moment. He (play) football.2 Lets go to a Chinese restaurant. I (love) Chinese food!3 I broke my finger while I (play) golf.4 I (meet) Greg a few times, but I dont know him very well.5 Before Simon went to sleep, he ___ (read) the book.6 How long (you / know) Tina?7 I cant help (feel) upset when I see animals in the zoo.8 I (not / see) Freddie at the party last night.9 Unfortunately, the film (start) when I got to the cinema, so I missed the first ten minutes.10 My parents always encouraged me (do) a lot of sport. Rsume sous forme de recette le livre Becassine Pendant la Grande Guerre.C'EST URGENT C'EST A REPONDRE AUJOURD'HUI 4.) Karl started his day with $17 in his wallet. He spent$5.24 for lunch and $10.65 on a book. How much moneydoes he have left? (Show your work) Should geography be harnessed specifically for human gain? The Renaissance begins when Cosimo de Medici and his friends search Europe for ____________. Simply reading pagan authors like Socrates and Plato was punishable by excommunication from the church I need helpn asap , i been on this for the longest When the dry and wet bulb temperatures are far apart. the humidity is high.TrueFalse The angle measurements in the diagram are represented by the following expressions.BSolve for x and then find the measure of Given the following list of numbers, find the mean. 5,6,12,2,5,12,14 here is the CORRECT answer to all you guys answering with semiarid Universal Container wants to understand all of the configuration changes that have been made over the last 6 months. Which tool should an Administrator use to get this information 1. While cell phones provide Freedom and mobility,they can also become a leash, compelling user's to answer them anywhere and anytime How many years will it take for $20,000 to earn $7,000 in interest if placed in an account that earns 2.09% simple interest? I NEED HELP ASAP PLEASERead the poem.Ozymandiasby Percy Bysshe ShelleyI met a traveller from an antique land,Who saidTwo vast and trunkless legs of stoneStand in the desert. . . . Near them, on the sand,Half sunk a shattered visage lies, whose frown,And wrinkled lip, and sneer of cold command,Tell that its sculptor well those passions readWhich yet survive, stamped on these lifeless things,The hand that mocked them, and the heart that fed;And on the pedestal, these words appear:My name is Ozymandias, King of Kings;Look on my Works, ye Mighty, and despair!Nothing beside remains. Round the decayOf that colossal Wreck, boundless and bareThe lone and level sands stretch far away.What is the structure of "Ozymandias"?limericksonnetfree versehaiku Which type of cell are found in the leaves of a tree?O eukaryotic animalO chloroplasticO prokaryoticO eukaryotic plant together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?. Lots of points please help TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA