what’s 100/12 as a mixed number

Answers

Answer 1

Answer: 8 1/3

Step-by-step explanation:

100/12 = 8.33333333

8 4/12

8 1/3


Related Questions

Which of these expressions equal 15 when x=1/2 and y=3? Circle all that apply. Please help with this my teacher need me to work out xy+3 1/2+20x Btw guys 3 1/2 are mixed numbers if your wondering

Answers

Answer:

15

Step-by-step explanation:

First you would replace the x and y's with 1/2 and 3.

So it would look like: (1/2) (3) + 3 1/2 + 20 (1/2)

Next, you go by PEMDAS (parenthesis, exponents, multiplications, division, addition, subtraction)

So you would first multiply and the parenthesis that I added mean multiplication.

1.5 + 3.5 + 10

So then all that is left to do is add because I multiplied everything out.

So it is 5 + 10 which is 15

Melissa is 13 years old. Becky is 12 years old. Daniel is 10 years old. Melissa, Becky and Daniel share £42 in the ratio of their ages. Becky decided to save a third of her share. How much will Becky have to spend?

Answers

Answer: Becky will have to spend £ 9.6 .

Step-by-step explanation:

The ratio of their ages will be:

Melissa : Becky : Daniel = 13 : 12 : 10

Total amount share = £42

Share of Becky = [tex]\dfrac{12}{12+13+10}\times42[/tex]

[tex]=\dfrac{12}{35}\times42\\\\= 14.4[/tex]

Hence, Becky's share = £14.4

Becky decided to save a third of her share.

Then, Amount she spend = [tex]14.4-\dfrac13 \times 14.4[/tex]

[tex]=14.4-4.8\\=9.6[/tex]

hence, Becky will have to spend £ 9.6 .

Which answer best describes the shape of this distribution?
bell-shaped skewed left
8 9 10 11 12 13 14 15 16 17
s § 10 11
skewed right
uniform
Next

Answers

Answer:

skewed right

Step-by-step explanation:

I took the k12 test and I got the answer right

helpppp fasttt What is the area of the shaded region

Answers

Answer:

50.2 cm^2

Step-by-step explanation:

Formula for the area of a circle: [tex]\pi r^{2}[/tex]

Radius of bigger circle = 5

Area of big circle = 25 * 3.14 = 78.5

Radius of smaller circle = 3

Area of small circle = 9 * 3.14 = 28.26

Now, we subtract:

78.5 - 28.26 = 50.24 <--- Because we have to round to the nearest tenth, the final answer is 50.2

Answer:

50.2 cm²

Step-by-step explanation:

Find the area of both circles and subtract them.

what is least common multiple of 16 and 76​

Answers

Answer:

304

Step-by-step explanation:

Answer:

lcm(76,16) = 304

Step-by-step explanation:

The multiples of 76 are … , 228, 304, 380, ….

The multiples of 16 are …, 288, 304, 320, …

The common multiples of 76 and 16 are n x 304, intersecting the two sets above, n\neq 0 \thinspace\in\thinspace\mathbb{Z}n  

​  

=0∈Z.

Solve the inequality -15k>-120

Answers

Answer:

-15k<-120

Step-by-step explanation:

15k isbigger than -120 but less close to 0 as 15k is

What is the answer to this question really need the answer

Answers

Answer:

A, B, D

Step-by-step explanation:

2 x 3x =6x - 2 times 9y which equals 18y+ and 2 times 18 equals 36 so 2(3x-9y+18)

jenna has a piece of paper that is 84 square inches in area. it is 10 1/2 inches long. what is the width of the piece of paper in square inches

Answers

Answer: the paper is 8 inches

Step-by-step explanation: I'm sure the answer is 8.

Do 84 divided by 10 and 1/2

Find the volume of this cuboid.
6 cm
8 cm
10 cm

Answers

Answer: the volume is 480 cm

Step-by-step explanation:

You find the volume of a shape by multiplying the base x width x height. In this case the height is 6 the width is 8 and the length is 10. 6x8x10= 480.

Answer:

lb×bh×hl

6×8×8×10×10×6

48×80×60

230400

28
6. Hannah has 229 horse stickers and
164 kitten stickers. How many more
horse stickers than kitten stickers does
Hannah have?

Answers

Subtract 229 and 164 its 65 so thats your answer .

BRAINLIST TO WHOEVER CAN HELP ME


Demonstrate that the commutative property of addition is valid by solving for the sum of 5/6 and 8/9.

Answers

I. Hope this helps!!

PLEASE ANSWER ASASP
16d + 5 = -10
what is d?

Answers

Answer:

d  = -15/16

Step-by-step explanation:

To solve for D, you have to get D alone on one side of the equation (one side of the equal sign).

So get rid of the other numbers that are being added or subtracted to d first. To do that, you have to do the opposite of what is being done.

So u have +5 on the left, you have to minus it to get rid of it. Whatever you do on one side of the equation, you have to do to the other side

so 16d +5 minus 5 = -10  minus 5

the 5 cancels out on the left   and -10 - 5 = -15

now you have 16d = -15

Now you have to get rid of the 16. It's being multiplied to d so to do opposite is to divide it by 16. And whatever you do on one side, u have to do on the other.

16d divided by 16 = -15 divided by 16

16d/16 = d       -15/16  

So d = -15/16

For the expression, value of d is,

⇒ d = - 15/16

What is an expression?

Mathematical expression is defined as the collection of the numbers variables and functions by using operations like addition, subtraction, multiplication, and division.

Given that;

The expression is,

⇒ 16d + 5 = - 10

Now, We can solve the expression as;

⇒ 16d + 5 = - 10

Subtract 5 from both side;

⇒ 16d + 5 - 5 = - 10 - 5

⇒ 16d = - 15

Divide by 16 both side;

⇒ d = - 15/16

Therefore, For the expression, value of d is,

⇒ d = - 15/16

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ2

solve the following equations 4x-3=23-x​

Answers

Answer:

Step-by-step explanation:

GIVEN

4x - 3 = 23 - x

4x + x = 23 +3

5x = 26

x = 26/5

pls answer asap don’t troll and explain why !!

Answers

Answer:

I need help on this same question---_---

yes.

a triangle just needs to have three sides that connect at their ends nothing more

DJ Mykel is making a playlist for a radio show; he is trying to decide what 14 songs to play and in what order they should be played. Step 1 of 2 : If he has his choices narrowed down to 7 hip-hop, 5 jazz, 7 pop, and 8 blues songs, and he wants to play no more than 3 hip-hop songs, how many different playlists are possible

Answers

Answer:

5878600 different playlists.

Step-by-step explanation:

Since we require 14 songs for the playlist and there are 7 hip-hop, 5 jazz, 7 pop, and 8 blues songs, and DJ Mykel wants to play no more than 3 hip-hop songs, the number of ways in which he can combine the 7 hip-hop songs to play no more than 3 is ⁷C₃ = 7!/4!3!.

Now, since we have 3 songs already selected, we are left with 14 - 3 = 11 songs to select.

Since we have selected the 3 hip-hop songs, we are left with 5 jazz, 7 pop, and 8 blues songs which sum to a total of 20 songs.

So, we have 20 songs to select in 11 ways which is ²⁰C₁₁ = 20!/(20 - 11)!11! = 20!/9!11!

So, the number of different playlists that can be formed is thus

⁷C₃ × ²⁰C₁₁ =  7!/4!3!.× 20!/9!11!

= 35 ×  167960

= 5878600 different playlists.

Which is a factor of 72

Answers

Answer:

1,2,3,4,6,8,9,12,18,24,36 and72

The students in Miss Jackson's class are collecting pennies they decide to displayed in his facts of 10 how many stacks can they make with 345 pennies how many single pennies will they have left

Answers

34 Stacks of 10 with 5 pennies left.

Answer:

34 stacks with 5 pennies left

Step-by-step explanation:

345 / 10 = 34.5

10 * 34 = 340

345 - 340 = 5

Describe the end behavior of a ninth-degree polynomial with a negative leading coefficient

Answers

Given:

The degree of polynomial = 9

Leading coefficient is negative.

To find:

The end behavior of the polynomial.

Solution:

Let the polynomial be P(x).

We have,

Degree of polynomial = 9, which is odd.

Leading coefficient is negative.

If the degree of a polynomial is odd and leading coefficient is negative, then

[tex]P(x)\to \infty\text{ as }x\to -\infty[/tex]

[tex]P(x)\to -\infty\text{ as }x\to \infty[/tex]

Therefore, the end behavior of the given polynomial is [tex]P(x)\to \infty\text{ as }x\to -\infty,P(x)\to -\infty\text{ as }x\to \infty[/tex].

pls help the question is down there

Answers

Answer: 58in^2

Step-by-step explanation:

This is the most reasonable answer.

Rick purchases guitars wholesale for 60$ and then marks them up 150% before selling them online. How much doea Rick sell his guitars for?Real Answers Only​

Answers

Answer:

Rick sells each guitar for 90$

A square has a perimeter of 20 cm. What is the length of each side

Answers

Answer:

80cm

Step-by-step explanation:

20×20×20×20

hope this helped

A factory makes 12 bikes in 3 hours.
If it keeps making bikes at the same
rate, how many bikes will it have
made in 8 hours? (hint: set up a
proportion.)

Answers

12/3 = x/8

Cross multiply

3x = 96

Eliminate

3x/3 = 96/3

x = 32

Please help me answer this :)
Explain your answer

Will give brainiest

Answers

The image.... just look at it and count
What??? Please explain more

what is the solution set represented by this number line graph​

Answers

Answer:

x ≥ 2

Step-by-step explanation:

The dot is shaded on the point positive 2 and the arrow is going right so its x ≥ 2.

pls pls help !!!!! quick! pls!

Answers

Answer:

25.2

Step-by-step explanation:

Answer:

25.2

Step-by-step explanation:

4.8 x 6.3 is the smaller one and you want 4x the size of the same rectangle

so you are just multiplying each number by 4

4.8 x 4 =   19.2

6.3 x 4 =   25.2

An integer can be positive, negative, or _____. opposite zero equivalent

Answers

Answer:

Zero is nor a positive or negative number, so im guessing the answer is 0.

Step-by-step explanation:

Number 12. Find angle ADE

Answers

Answer:

ADE=59º

Step-by-step explanation:

4x+15+13x+7=90

17x+22=90

17x=68

x=4

angle B=angle ADE so we plug in x=4 into 13x+7

13(4)+7=59º

Angle ADE = 59 degrees
(4x+15)+(13x+7)=90degrees
17x+22=90degrees
68=17x
4=x
Angle DBC= 59 degrees
Angle DCB = 90degrees
Triangle = 180degrees
90+59=149
180-149=31 degrees
Angle EDC = 31
90-31=59 degrees
Angle ADE = 59 degrees


This equation has one solution.
5(x - 1) + 3x = 7(x + 1)
VA
What is the solution?

Answers

I think the answer is 12
The solution is x=12

HELPPPPPP PLEASEEEEWE ILL GIVE YOU 30 points!!!!! I have 4 minutes pleaseeee

Answers

The correct answer should be b

What is the GCF of 35 and 47

Answers

Answer:

The GCF of 35 and 47 is 1

Other Questions
How many years will it take for $20,000 to earn $7,000 in interest if placed in an account that earns 2.09% simple interest? I NEED HELP ASAP PLEASERead the poem.Ozymandiasby Percy Bysshe ShelleyI met a traveller from an antique land,Who saidTwo vast and trunkless legs of stoneStand in the desert. . . . Near them, on the sand,Half sunk a shattered visage lies, whose frown,And wrinkled lip, and sneer of cold command,Tell that its sculptor well those passions readWhich yet survive, stamped on these lifeless things,The hand that mocked them, and the heart that fed;And on the pedestal, these words appear:My name is Ozymandias, King of Kings;Look on my Works, ye Mighty, and despair!Nothing beside remains. Round the decayOf that colossal Wreck, boundless and bareThe lone and level sands stretch far away.What is the structure of "Ozymandias"?limericksonnetfree versehaiku Which type of cell are found in the leaves of a tree?O eukaryotic animalO chloroplasticO prokaryoticO eukaryotic plant together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?. Lots of points please help TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGGmRNA:Codon:Anticodon:Amino Acids: Given=42and=16, find DG. (help fast please)A. 38.8B.26.4C.44.9D.13.6 Is this statement true or false?Eleanor Roosevelt fought for the rights of the underdog for all those who were persecuted or treated unfairly including women, minorities, the poor, and children. Internal anatomy of the earthworm a. The mouth leads to what structure? b. After the esophagus, food passes through what three structures? c. Undigested particles are eliminated through the what? d. What is the purpose of the nephridium? e. What is the purpose of the seminal vesicles? f. Where are the seminal receptacles located? (repost) Help Please I will Give brainliest If Correct!! Write the equation of the line passing through the points (-7,4) and (7,2). Mia is a songwriter who collects royalties on her songs whenever they are played in a commercial or a movie. Mia will earn $50 every time one of her songs is played in a commercial and she will earn $120 every time one of her songs is played in a movie. How much would Mia earn if his songs were played in 5 commercials and 3 movies? How much would Mia earn if his songs were played in cc commercials and mm movies? Which statement best describes subduction? Can yall help please Factor the expression.2x + 8 Angela works 18 hours a week for 12 weeks in the summer at the local swimming pool as a life guard. She earns $13 per hour. Her employer takes 15 percent out of her check for federal income tax withholding and 6.2 percent for Social Security and 1.45 percent for Medicare. She will receive 12 paychecks, one for each week she works. Calculate Angelasweekly gross pay A line passes through the point (-10, -6) and has a slope of 1/2. Write an equation in slope-intercept form for this line. write an equation illustrating the condensation of p-diaminobenzene with the acid chloride of oxalic acid (cocl)2 Solve:(-5) + (-18) =A-13B--23C 23D13