What is the function of my DNA
Answer:
Your DNA is basically your human code
Explanation:
The DNA contains what makes you, well you, and it also contains the codes for how you will grow, your health, and reproduce. Your DNA is vital if it gets damaged or something happens along the way the message can't go through, that's when deformities and others things can happen.
What would happen to the blue spruce protein if a mutation occurred that inserted a T into the middle of the DNA sequence? *
Nothing it still codes for the same amino acids
Every amino acid in the chain changes, making the protein not functional
Only the amino acids coded for before the insertion change and the protein is still functional
Only the amino acids coded for after the insertion change and the protein is most likely not functional
Answer:
Every amino acid in the chain changes, making the protein not functional
Explanation:
The gene, or sequence of DNA, ultimately determines the unique sequence of amino acids in each peptide chain. A change in nucleotide sequence of the gene's coding region may lead to a different amino acid being added to the growing polypeptide chain, causing a change in protein structure and therefore function.
The opposite of flexing a muscle is called ______________the muscle.
Answer:
The opposing muscle of a flexor is called the "extensor" muscle. Your triceps is an extensor.
Explanation:
Hope it help
Answer:
The opposing muscle of a flexor is called the "extensor" muscle. When you contract your triceps your arm straightens and the angle between the forearm and the upper arm increases.
Explanation:
Adult female monkeys from one population breed with male monkeys of a nearby population. The introduction of new alleles into the first population's gene pool is an example of
Answer:
The introduction of new alleles into the gene pool of the first population, from another population, is an example of gene flow.
Explanation:
In population genetics, gene flow consists of the passage or transfer of gene alleles between populations, a process that is related to the migratory dynamics of a population.
When gene flow occurs, a population can gain new genetic material or lose it, which is reflected in traits or characteristics of that population.
If an adult monkey interbreeds with an adult monkey from another population there will be a gene flow that will probably introduce specific trait information into the gene pool of their respective populations.
A girl cycles for 3 hours at a speed of 40kn/h. What distance did she travel
Answer:
2 miles?
Explanation:
On a pedigree chart, males are represented by a circle and females are represented by a square.
A True
B False
Answer:
B False
Explanation:
I hope this helps! Have a great day!
Answer:
False
Explanation:
Its the other way around
1 po
6. Which of the following correctly describes how the sun's energy can
cause a tornado? *
A: The sun's energy directly powers the tornado.
B: The sun's energy heats the ground which then heats the air above it.
C: The sun's energy heats the air which then heats the ground below it.
D: The sun's energy is not related to tornados.
Answer:
C: The sun's energy heats the air which then heats the ground below it.
Explanation:
The fossil record is a history of life indicated by fossils found in Earth's
crust. What information about organisms in an environment can the fossil record provide?
A. How natural selection occurs
B. How organisms in an environment changed over time
C. How selective breeding occurs
D. How genetic variation occurs
Answer:B
Explanation:
It’s B because as time goes organisms change and they get buried under the fossil records to that’s why I think it’s B hope this helped
Which statement describes an example of the control of gene expression?
A Three types of RNA are made in the nucleus during the process of transcription.
B New polypeptides are made using amino acids brought to ribosomes by tRNA
molecules.
C Certain coding segments of mRNA are assembled after non-coding segments are
removed.
D RNA polymerase matches RNA nucleotide bases to the DNA bases of the coding
strand.
Answer:
D
Explanation:
The table lists general categories of blood disorders. Some information is missing, as shown by the letters X, Y, and Z.
Type of disorder
Reduced platelet counts
Categories of Blood Disorders
Primary impact on the body
Deprives cells of oxygen
Reduced WBC counts
Which list correctly completes the table in the order X, Y, Z?
O RBC malfunction, internal or external bleeding, reduced ability to fight infection
O reduced ability to fight infection, RBC malfunction, internal or external bleeding
O internal or external bleeding, RBC malfunction, reduced ability to fight infection
O internal or external bleeding, reduced ability to fight infection, RBC malfunetion
Answer:
C. internal or external bleeding, RBC malfunction, reduced ability to fight infection
Explanation:
WBC deals with the ability to fight off infection, RBC deals with delivering oxygen to cells, and platelets create blood clots for wounds, so if they weren't doing their jobs, you have have bleeding.
Hope this helps
Answer:C
Explanation:
Pls help fast I need to turn this in for Hw
5 and 6
Answer:
5. a
6. d
Explanation:
Which statement best describes the nature of scientific theories?
A: Scientific theories are unchanging
B: Scientific theories are frequently discarded.
C: Scientific theories can change with new evidence.
D: Scientific theories can become laws with further evidence.
Answer:
D
Explanation:
D: Scientific theories can become laws with further evidence.
Carbohydrates
act as "ID
cards" for cells.
Where are they
located?
Plasma membranes include carbohydrates as their third main component.
What are carbohydrates?They are often found attached to either lipids or proteins on the exterior of cells, where they form glycoproteins (forming glycolipids).
A cell wall containing a variety of polysaccharides and proteins surrounds the cells of both plants and fungi. In recent years, it has become clear that the cell wall's polysaccharides act as a signaling mechanism in plants in addition to maintaining the form and integrity of the cell.
In addition to being a component of cell membranes, covalently linked carbohydrates to proteins or lipids (glycoproteins or glycolipids) serve as sites for cell adhesion and addressing.
Therefore, according to the fluid mosaic model, proteins and carbohydrates float on top of a fluid lipid bilayer that makes up a membrane.
Learn more about cells, here:
https://brainly.com/question/11165837
#SPJ2
what physical changes did you experience when you were 13?
Answer:
i started getting more hair EVERYWHERE i mean everywhere. voice cracks started to come in. I realized stuff that i used to love i was drifting away from it. for ex. i used to like jake paul now i hate him. lol
Plzzzz help science
Answer:
the 2 one I'm pretty sureeee
Answer: Image 2
Explanation: It's image 2 because the unicellular organism just consists of one cell.
Use the following data to answer the questions that follow:
Cameroon TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAAT
Tsavo
TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAATCGCCTCCTCAAAT
Fannie Roberts TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAAT
Sabi Sands TTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTGAAAT
Umfolozi TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAAT
Zimbabwe TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAAT
Zambia
TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAAT
Kalahari TTCTCCATTCTTCTAATCCTAATACCCATCTCAGGCATTATCGAAAACCGCCTCCTCAAAT
Botswana TTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAAT
Etosha
TTCTCCACTCTTCTAATCCTAATACCCATCTCAGGCATTATTGAAAACCGCCTCCTCAAAT
5) What question can the data above help to answer? Write your question here:
cameroon: ughargjbendvnqergbe
tsavo:ergqirghrgjnqr;jg
fannie:ehrgbqwjgnwlgwe
sabi:ergnqwojnqwkgwr
umfolozi:rgnjbnldn;wdjnv
zimbabwe:qowehfsdjlfrgna
zambia:egn;wejncsdc
kalahari:hebrgjnaskdmc
botswana:uopwefanne;fj;qufu
etosha:el;krlnalr
hope thathelped4.
Which of the following best explains how viruses cause disease?
A. The virus particles ingest cells in order to
disrupt their processes. Ingesting cells allows viruses to continue to replicate.
В.
The virus particles digest parts of the host cell mechanism to create more viruses. The cell is left without means to replicate
С
The virus particles infect host cells and use the host cell's machinery to create more viruses. This disrupts the host cell's processes.
D
The virus particles invade host cells and use the host cell's machinery to create many more host cells. This causes overproduction of cells
Answer:
uhhh B
Explanation:
because that actually does happen and it gets in your intestine system then you breath it in and the cell is gone
Which of the following actions is an example of organisms exchanging information in response to an internal cue?
A. Prairie dogs issue alarm calls upon seeing a predator.
B. Honeybees perform a dance to direct other bees to a food source.
C. Ants use chemical signals to alert other ants to an intruder.
D. Female chimpanzees solicit mates when they are ovulating.
Answer:
female chimpanzees solicit mates when they are ovulating
Triglycerides are compounds created by combining a molecule of glycerol with three fatty
acids. Triglycerides are used to store large amount of energy and are classified as a form of
which biomolecule?
O proteins
nucleic acids
carbohydrates
lipids
Help quick
Which of the following solutions is the most acidic?
Group of answer choices
A solution with a pH of 13
A solution with a pH of 2
A solution with a pH of 7
A solution with a pH of 9
Flag this Question
Question 2
Which of the following solutions is the most basic?
Group of answer choices
a solution with a pH of 13
a solution with a pH of 2
a solution with a pH of 7
a solution with a pH OF 9
1st Question
PH of 2
2nd question
PH of 13
MAKE ME A PARAGRAPH I WILL GIVE BRAINLIESTTTTTTT
In your paragraphs, you are to describe in detail the reason we have day and night, and you are also to describe in detail why we have each season. So... in your paragraphs, you should thoroughly explain the factors that cause us to have day and night. You should also describe EACH season. What factors cause us to have spring? Summer? Winter? Fall? The model that you create should demonstrate each of these things, too, and should clearly show the reason we have day and night, and the reason we have each season.
Your written explanation should include information about how the earth's rotation on its axis causes day and night.
Your explanation of each season should include information about how the tilt of the earth on its axis, the amount of direct or indirect sunlight we receive, and earth's position as it revolves around the sun, causes each season. Your written explanation of these things needs to be specific and thorough.
Answer:
We have day and night because the Earth rotates. It spins on its axis, which is an imaginary line passing through the North and South Poles. The Earth spins slowly all the time, but we don't feel any movement because it turns smoothly and at the same speed.
ANSWER QUICK PLEASE !!!
what is similar and different about the three forelimbs ? How does this information provide evidence of common ancestry?
Answer:
Homology, in biology, similarity of the structure, physiology, or development of different species of organisms based upon their descent from a common evolutionary ancestor.
which part changes in the different nucleotides
Answer:
Explanation:
The phosphate group (PO4) is what differentiates a nucleotide from a nucleoside. This addition changes the nucleoside from a base to an acid. These phosphate groups are important, as they form phosphodiester bonds with the pentose sugars to create the sides of the DNA “ladder.
The sugar in DNA is deoxyribose. Deoxyribose differs from ribose (found in RNA) in that the #2 carbon lacks a hydroxyl group (hence the prefix “Deoxy”). Nucleotides in DNA contain four different nitrogenous bases: Thymine, Cytosine, Adenine, or Guanine.
Small structures inside cells that perform specific functions are called:
ОА. АТР
B. Organelles
C. Plastids
D. Lipids
Answer:
B. Organelles
Explanation:
they are called
Answer:
organelles I believe, hope this helps
Homeostasis is the process of maintaining a cell's environment. This
includes the regulation of sodium ion (Na+) concentration within the
cytoplasm. If too much Na+ is inside a cell, how can the concentration be
changed?
One thing people in the United States could do to reduce air pollution is
a. drive their cars more.
b. bum more fossil fuels.
use more public transportation.
d. build more factories.
Sam had a disease that weakened his heart so it could not pump properly. This heart problem
caused him to have low energy because his cells could not get the nutrients they needed.
Based on this information, Sam's disease primarily affected the functions of which two
systems?
1. skeletal system and digestive system
2. muscular system and cardiovascular system
3. integumentary system and muscular system
4. excretory system and cardiovascular system
Plz answer quick
Answer:
2. muscular system and cardiovascular system
Please help me akshdakdhakdhskk
Answer:
nucleotide, dna, gene, chromosome
Are Eukaryotic cells complex or simple?
Answer:
Complex because it has a lot of membrane bound organelles
I think so. They have their own energy factories (mitochondria) and their DNA is linear and found in the nucleus.
Is this statement true or false? Voluntary muscles move when you want them to, while involuntary muscles move automatically. I don't know the answer :(
