Which statement describes the effect of Charlemagne's conquests on Europe?
Europe was brought together as a single empire.
Europe became divided into small warring states
Europe developed into powerful city-states
Europe separated into two rival kingdoms.

Which Statement Describes The Effect Of Charlemagne's Conquests On Europe?Europe Was Brought Together

Answers

Answer 1

Answer:

Europe was brought together by a Single Empire

Explanation:

Sorry hope I’m not to late


Related Questions

which constitution of Nepal declared the country a federal nation​

Answers

Answer:5th amendment of the Interim Constitution of Nepal

Explanation:

Refused to ratify the Constitution without a bill of rights (Federalist or Anti Federalist)

Answers

Answer:

sorry  not enogh info

who is Hugh Waddell.. please help​

Answers

Answer:

he was a major general during the french and indian war and supervised the building of fort dobbs

Answer:

Hugh Waddell was a colonial military and political official, merchant, and planter, was born in Lisburn, County Down, Ireland,

Explanation:

I hope this helps! Let me know if you need more info!

what do you understand by rule of law​

Answers

Answer:

Rule of law is a legal maxim that suggests that no one is above the law and governmental decisions must be made only by applying known legal and moral principles.

What was the crop that people arriving in the colonies wanted to grow?

A) Corn
B) Cotton
C) Potatoes
D) Tobacco
Plz hurry I will mark brainliest

Answers

Corn is the standard expected answer though they grew many crops

Answer:

d) tobacco

Explanation:

Quiz
Active
1
TIME REMAI
57:23
he
In a federal system of government, power is....?
divided between the national government and the states.
held by one person who makes all the decisions.
held by a central government that makes decisions.
O divided equally between all state governments.

Answers

Answer:

A. divided between the national government and the states.

Explanation:

right on edge 2021

In one paragraph, name two specific challenges that
people on the Balkan Peninsula face. What is a cause of
these challenges?

Answers

Answer:

One of them are bad economical position of most of the countries and the second one is nationalism that led to many wars in recent years.

Explanation:

Most of the Balkan states are post-communist societies, that are very undeveloped, especially when compared to  other European states. Some of them, such as Albania, Montenegro, Serbia, North Macedonia are not even a part of EU which makes their economies even weaker, as they don't have opened marker.

Another great problem is nationalism, often strengthen by the religion. During the 90s even wars were led, especially on the soil of Ex-Yugoslavia that are still troubling these societies.

Does anyone know pls help...

Answers

Answer: It's A

Explanation:

A for sure








Have a great day

what type of skilled human resources do you like to be in future why​

Answers

The future of HR will be about delivering three things to the organization. Efficient and effective human capital processes— streamlining, standardizing, and integrating talent management processes across the organization (recruiting, training, performance management, rewards, and retention).

Approximately what percentage of people report getting their news primarlly from social media sites?
A. 8%
B.28%
C.48%
D.78%

Answers

Answer:

D.78%

Explanation:

According to the Pew Research Center, 78% of people in the United States said they get their news from social media

What animal did the ancient romans like to use in some of their art and architecture

Answers

Answer:

Wolves, bears, wild boar, deer and goats were native to Rome and other animals were introduced following conquests abroad. Elephants, leopards, lions, ostriches and parrots were imported in the 1st Century B.C. followed by the hippopotamus, rhinoceros, camel and giraffe.

Explanation:

Which is the second largest nation?
Canada
United States
Australia
Russia

Answers

Answer:

canada

Explanation:

The US is just a little bit smaller

Answer:

the answer to this is A) canada

4. Explain two ways in which the Ka'aba is important in the Muslim Hajj (pilgrimage).
Refer to scripture or sacred writings in your answer. (5 marks)​

Answers

Sweet free points are hawt

Question 1
Which of the following is true about both the planets and the stars we see in the night sky?
They are several light-years away.
They appear to move through the sky.
They can only be seen because they reflect light.
O
They twinkle when viewed at night.

Answers

HHzhsjjshavavsbsbvxvxhzhsh

Under the rule of Octavian, what role did the Senate play?

a. They commanded the military.
b. They acted as advisors to Octavian.
c. They made the laws.
d. They wrote Rome's budgets and raised taxes.

Answers

Answer:

D

Explanation:

I am a history teacher.

Answer:

b

Explanation:

Do you think he would approve of the way we treat one another today?
Why or why not?

Answers

Answer:

no

Explanation:

everyone literally so rude in the internet nowadays :c

also who's 'he' in your question?

definitely not, he wanted peace although world peace will never happened. but he wouldn’t like or approve of what’s happening in the world today

Describe the difference between sociology and psychology.

will mark you brainliest :)

Answers

Answer:

yeah what the person said above :)

Explanation:

Answer:

Psychology is the study about the individual while sociology is more about the society as a whole. Psychology studies how the individual functions within society while sociology studies how the society functions for the individual

May 9th.

Our lawful (?) owners have at last arrived. About sunset, day before yesterday, the Iroquois anchored here, and a graceful young Federal stepped ashore, carrying a Yankee flag over his shoulder, and asked the way to the Mayor's office. I like the style! If we girls of Baton Rouge had been at the landing, instead of the men, that Yankee would never have insulted us by flying his flag in our faces! We would have opposed his landing except under a flag of truce, but the men let him alone, and he even found a poor Dutchman willing to show him the road!

–A Confederate Girl’s Diary,

Sarah Morgan Dawson

Based on this passage, what is Dawson’s opinion of the women of her community?

She believes that they are stronger than the men in her area.
She thinks that they are weaker than men and easier to control.
She believes that most of them side with the Union in the conflict.
She thinks that they do not understand the situation the South faces.

Answers

Answer:

She believes that they are stronger than the men in her area.

Explanation:

Answer:

It's A.

Explanation:

Evidence of the Holocaust includes mass graves, tattoos on arms of survivors (and the dead), and German records.
a true
b fales

Answers

Answer:

Correct answer is a. true.

Explanation:

Holocaust is one of the greatest crimes committed in human history with a goal to erase Jewish population.

Although, Nazis tried to destroy the records of Holocaust, today we have many evidences that are leading us to conclusion that all these crimes were planned.

Prisoners in death camps were tattooed, so they would be differentiated between each other.

Mass graves that were found are showing us how great those atrocities were.


Contrast What were
the consequences of
the war for Filipinos?
for the Americans?

Answers

Answer: A short but ruthless war.

Explanation:

The Americans dominated throughout the war. The Filipinos were not able to oppose the superior American troops. Also, they did not gain international support, which continuously affected the procurement of ammunition and weapons. About 4,000 American soldiers and over 20,000 Filipinos were killed during the war and many civilians. The victory in the war gave the United States a significant strategic place. In the Asia-Pacific region, the United States has expanded its military and economic capacities. Thus the united states expanded its influence in that part of the world. The Philippines gained independence over time, which had been encouraged since the beginning of the war, but full autonomy had to wait for some time.

Which of the following statements is true about the state governments and national government under the Articles of Confederation?

Answers

Answer:

Under the Articles, the states, not Congress, had the power to tax. Congress could raise money only by asking the states for funds, borrowing from foreign governments, or selling western lands. In addition, Congress could not draft soldiers or regulate trade. There was no provision for national courts.

Explanation:

There were not any multiple choice answers to choose from so I hope this helps.

Which are two politics within the national congress? How they different with each other​

Answers

Answer:

Two-party system, political system in which the electorate gives its votes largely to only two major parties and in which one or the other party can win a majority in the legislature. The United States is the classic example of a nation with a two-party system.

Explanation:

could you help me with this question

Answers

It was sharpened into a spearhead for the most accuracy

Why was the womans Christian temperance unión formers

A is to increase school enrollment
B is to discpurage alcohol consuption
C is to provide health classes for the por
D is to fight for women labor rights. Please help!!!

Answers

Answer:

Option: B.  to discourage alcohol consumption.

Explanation:

The Woman Christian temperance union forms in 1874 to fight the influence of alcohol on families and society in America. The Union was responsible for bringing significant social change. These women believed drinking to be the cause of problems in society. To reach their purpose, women protested in bars and saloons by singing, praying, and destroying alcohol. Their efforts were capable of closing a thousand bars and saloon around the United States.  

how do these two events relate to each other?

Answers

Answer:

I need two events relate to each other

Explanation:

so I can answer the question

A bridge usually has expansion joints. They allow the bridge to become slightly longer when it experiences thermal expansion. Look at the diagram below of the bridge joint. When the weather becomes cool, the “teeth” of the joint move away from each other. When the weather becomes warm, they move toward each other. Which statement is true about the particles that make up the bridge? A. When the sides of the joint are close together, the particles have more kinetic energy than they do when the sides are farther apart. B. When the sides of the joint are far apart, the particles have more kinetic energy than they do when the sides are closer together. C. The particles contain the same amount of kinetic energy no matter how much the bridge has expanded. D. The kinetic energy of the particles changes, but the amount it changes does not depend on the temperature of the bridge.

Answers

Answer:

I think it's A.

Explanation:

Answer:a

(a)i took it

Explanation:

Identify one effect of the creation of Gutenberg’s press.
a. literacy rates increased
b. scientific discoveries were less likely to be widely known
c. interest in the Americas declined
d. the middle ages

Answers

Answer:

A. Literacy rates increased

Explanation:

Before the Gutenberg press was created, people depended on the priest or the literates to read to them about the bible or the news. They were not telling the truth about what the bible really said, and used people's fear to make them buy Indulagence. However, Martin Luther was against this and wrote books preaching against the church. A way to get these new teachings to the people was to make many copies of them by using the Gutenberg press.

Which sentence below is tariff used correctly? A. All states charge a tariff B. A tariff is charged to mail a letter C. Americans are required to pay a tariff at the airport D. A tariff was added to the Chinese imports.

Answers

Answer:

D. A tariff was added to the Chinese imports.

Explanation:

In economics, Tariffs refers to a additional amount that a company need to pay to gain permission to sell their product in a certain country.

This could be seen in option D.

Typically, Tariffs will increase the amount of price needed entering the market. Because of this, the company that imported the product had to increase the price of their product.  This will make the imported products seems more univariable by the local customers.

This is why  Tariff is generally an effective measure to help local businesses compete with foreign businesses.

Complete all and brainliest too❤️

Answers

Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong.

What is the main idea of the article "Biden takes the helm as president: "Democracy has prevailed""? Please read the passage if you can on Newsela and get the answer here as quickly as possible. First to answer gets Brainliest and 15 points!

Answers

Joe Biden was sworn in as the 46th president of the United States on Wednesday, summoning American resilience to confront a historic confluence of crises and urging people to come together to end an “uncivil war” in a nation deeply divided after four tumultuous years

Declaring that “democracy has prevailed,” Biden took the oath at a U.S. Capitol that had been battered by an insurrectionist siege just two weeks earlier.

On a chill Washington morning dotted with snow flurries, the quadrennial ceremony unfolded within a circle of security forces evocative of a war zone and devoid of crowds because of the coronavirus pandemic. Instead, Biden gazed out over 200,000 American flags planted on the National Mall to symbolize those who could not attend in person.

“The will of the people has been heard, and the will of the people has been heeded. We’ve learned again that democracy is precious and democracy is fragile. At this hour, my friends, democracy has prevailed,” Biden said. “This is America’s day. This is democracy’s day. A day in history and hope, of renewal and resolve.”
Other Questions
How many years will it take for $20,000 to earn $7,000 in interest if placed in an account that earns 2.09% simple interest? I NEED HELP ASAP PLEASERead the poem.Ozymandiasby Percy Bysshe ShelleyI met a traveller from an antique land,Who saidTwo vast and trunkless legs of stoneStand in the desert. . . . Near them, on the sand,Half sunk a shattered visage lies, whose frown,And wrinkled lip, and sneer of cold command,Tell that its sculptor well those passions readWhich yet survive, stamped on these lifeless things,The hand that mocked them, and the heart that fed;And on the pedestal, these words appear:My name is Ozymandias, King of Kings;Look on my Works, ye Mighty, and despair!Nothing beside remains. Round the decayOf that colossal Wreck, boundless and bareThe lone and level sands stretch far away.What is the structure of "Ozymandias"?limericksonnetfree versehaiku Which type of cell are found in the leaves of a tree?O eukaryotic animalO chloroplasticO prokaryoticO eukaryotic plant together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?. Lots of points please help TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGGmRNA:Codon:Anticodon:Amino Acids: Given=42and=16, find DG. (help fast please)A. 38.8B.26.4C.44.9D.13.6 Is this statement true or false?Eleanor Roosevelt fought for the rights of the underdog for all those who were persecuted or treated unfairly including women, minorities, the poor, and children. Internal anatomy of the earthworm a. The mouth leads to what structure? b. After the esophagus, food passes through what three structures? c. Undigested particles are eliminated through the what? d. What is the purpose of the nephridium? e. What is the purpose of the seminal vesicles? f. Where are the seminal receptacles located? (repost) Help Please I will Give brainliest If Correct!! Write the equation of the line passing through the points (-7,4) and (7,2). Mia is a songwriter who collects royalties on her songs whenever they are played in a commercial or a movie. Mia will earn $50 every time one of her songs is played in a commercial and she will earn $120 every time one of her songs is played in a movie. How much would Mia earn if his songs were played in 5 commercials and 3 movies? How much would Mia earn if his songs were played in cc commercials and mm movies? Which statement best describes subduction? Can yall help please Factor the expression.2x + 8 Angela works 18 hours a week for 12 weeks in the summer at the local swimming pool as a life guard. She earns $13 per hour. Her employer takes 15 percent out of her check for federal income tax withholding and 6.2 percent for Social Security and 1.45 percent for Medicare. She will receive 12 paychecks, one for each week she works. Calculate Angelasweekly gross pay A line passes through the point (-10, -6) and has a slope of 1/2. Write an equation in slope-intercept form for this line. write an equation illustrating the condensation of p-diaminobenzene with the acid chloride of oxalic acid (cocl)2 Solve:(-5) + (-18) =A-13B--23C 23D13